Click to See Complete Forum and Search --> : MATLAB file operation , regarding DNA (bio-informatics)


king_of_kings
April 3rd, 2006, 10:38 PM
hello every one.This is my first thread in code guru.

I need to write a program in matlab to open a file having a large DNA string
(about 43000 characters).Then i need to compare the entire DNA string with
the 64 codons.Hope you know what is a codon.
So finally i need to get a plot with 64 codons on X-axis and the number of c
odon in the entire DNA string on Y-axis.


For example I have a DNA string like this

acttcagtgcatgctgcatg (20 characters)

So when i run the program it must compare the string with the 64 codon and c
ount the number of occurences of each codon in entire dna string.
So the final answer from above example is act=1,tca=1,gtg=1,cat=1,gct=1,gca=1 and ignore the odd final characters because it has only 2 characters and d
oesn't make a codon.


Finally i need a plot with the 64 codon on x-axis and the number of occurences of each codon on y-axis

yiannakop
April 11th, 2006, 03:36 AM
I believe u should post this thread in Algorithms and Data Structures Forum.

:wave: